60.000
TCGATCTAGCCATCGATCTAGCTCGACTACTTCGATCTAGCCATCGATCTAGCTCGATTACTGATCTATAG
CTCTAGCTCTCGGATCTACTTAGATCTACGATGATCTAGCCATCTACAATCTACGATGATCTAGCCATCTA
Danish National Genome Center

The treatment of the future begins now

At the Danish National Genome Center, our mission is to create a better future for patients in Denmark.

Watch a patient's story about personalised medicine

Danish National Genome Center

News

You can sign up to NGC’s news

News

Career opportunities

Work with us

We look forward to receiving your application

Work with us

National Strategy

Personalised medicine

The strategy applies for the period 2021-2022

The Strategy